Sequencing

From BioInfo

Jump to: navigation, search

Contents

[edit] Introduction

The Huntsman Cancer Institute purchased an Illumina GA II next generation sequencer in early 2008 and a Illumina HiSeq2000 next generation sequencer in 2010. Both of these instruments were placed under the management of the Microarray Core Facility. The GAIIis instrument has been upgrade to a GAIIx. Both instruments are able to support either single read or paired end sequencing with read lengths that range from 36 bases to 101 bases. Bioinformatic assistance with high throughput sequencing data analysis is available through the Bioinformatics Core Facility.


[edit] Illumina Sequencing

The Microarray and Genomic Analysis Core Facility currently has two Illumina HiSeq 2000 instruments and one Illumina MiSeq. Both instruments use Illumina's reversible terminator sequencing by synthesis-based chemistry.

A HiSeq 2000 can deliver 150 to 200 million reads per end (300-400 million reads in a paired end run) in each lane. Standard Run profiles for the HiSeq include 50 bp single read (>85% base calls higher than Q30) and 101 bp paired end (>80% of base calls higher than Q30). We also occasionally run 101 bp single read and 50 bp paired end read sequencing runs. A HiSeq sequencing run takes 3 (50 cycle single end read) to 11 (101 cycle paired end read) days to complete.

An Illumina MiSeq delivers 15-17 million reads per end (30-34 million paired end reads). Standard run profiles on a MiSeq include 25 bp paired end (>90% base calls higher than Q30), 150 bp paired end (>80% base calls higher than Q30) and 250 bp paired end (>70% of base calls higher than Q30). A MiSeq sequecning run takes 6 to 39 hours to complete depending on the run parameters.

[edit] Sample Submission

  • Follow the recommendations below and when in doubt contact Brian Dalley for instructions on sample preparation methods.
  • GNomEx, the Microarray and Genomic Analysis Core Facility LIMS (GNomEx) should be used for documenting experimental details regarding your Illumina sequencing request. All Illumina sequencing requests should be electornically submitted through GNomEx prior to sending samples to the Microarray Core Facility.
  • A GNomEx database account can be setup by completing the information required on the following link ([1]). University of Utah investigators can log in to GNomEx using their uNID and CIS password.
  • Billing for Univesrity of Utah investigators in performed electronically following the completion of work. Prior to initiating an order for Illumina sequencing, the lab group should electoronically submit a work authorization by providing chartfield information for the account to be billed using the following link ([2]).
  • Customers that are not affiliated with the University of Utah can pay either by generating a Purchase Order or by credit card (Visa or Mastercard). A quote for the estimated charges can be provided if needed.
  • GNomEx, the Microarray Core Facility LIMS (GNomEx) should be used for documenting experimental details regarding your Illumina sequencing request. All Illumina Sequencing requests should be electornically submitted through GNomEx prior to sending samples to the Microarray and Genomic Analysis Core Facility. GNomEx will generate database ID numbers for each sample and the database ID number should be inscribed on the top of 1.5 ml microfuge tubes containing your samples. You can inscribe the sample names on the side of each tube.
  • Sequencing access is provided on a first come/first serve basis.

[edit] Sample Preparation and Data Processing

  • Samples submitted for Illumina Sequencing services will be analyzed by appropriate quality control measures (NanoDrop, Qubit, Bioanalyzer, gel electrophoresis) to access the quantity and quality of the sample.
  • Samples that pass quality control steps will be used for generating an Illumina sequencing library using the appropriate sample prep kit. If the quality of a sample is suspect or if there is insufficient sample to construct a sequencing library, a member of teh core facility will contact the investigator.
  • Investigators have the option of constructing the sequencing library within their own laboratory. A fraction (15 ul) of the library can then be submitted to the Microarray and Genomic Analysis Core Facility for sequencing.
  • Following the construction of a sequencing library, an aliquot of the library will be run on an Agilent Bioanalzyer chip to validate the quality and size range of the library. The library will also be qualified by qPCR to establish the molarity of cluster-forming molecules in the library. This step enables us to load an appropriate quantity of the library on a flowcell as a means to optimize cluster density during the sequencing run. We are able to further optimize cluster denisty if additional lanes of the same sample are run on future sequencing runs.
  • Sequencing libraries will then be run on either the Illumina Genome Analyzer IIx or the HiSeq2000.
  • The Illumina HiSeq 2000 and the MiSeq uses real time analysis software in additon to analysis pipeline software to call bases from the image files, generate reads, and deconvolute index tags on the sequencing libraries. Sequence reads will be made available to the investigator for download from GNomEx.
  • Sequence reads can be mapped to a to a genome build of choice by contacting the Bioinformatics Core Facility. See pipeline user guide. Additional bioinformatic analysis can be requested from the Bioinformatic Core. Tools for data analysis that were developed by the Bioinformatics Core may be found at USeq.

[edit] Recommendations for Illumina DNA Sample Preparation

Illumina Genomic DNA Sequencing provides a cost effective solution to sequence entire genomes. We provide four options for genomic DNA library construction:

  • Genomic DNA Library construction: Illumina Genomic DNA Sequencing provides a cost effective solution to sequence entire genomes. All Illumina TruSeq sample preparation kits enable multiplexing of different libraries within the same sequencing lane. Sequencing libraries for large genomes can be sequenced on a Illumina HiSeq 101 Paired End sequencing run which delivers approximately 30-40 billion bases of sequence per lane. Alternatively, sequencing libraries derived from organisms with small genomes can be sequenced on either a HiSeq 50 cycle single end read (150 to 200 million reads per lane) or on a MiSeq (which can deliver up to 7.5 billion bases per lane). We provide four options for genomic DNA library construction:
    • The Illumina TruSeq DNA Sample Preparation Kit [3]requires 10-1000 ng of genomic DNA and yields a library with an average insert size of 180 to 450 bp. Library construction will include 2 to 10 cycles of pcr depending on the quantity of input DNA.
    • The Illumina TruSeq DNA Sample Preparation Kit [4] can be used with a custom size selection option that is performed by isolating a defined insert size following agarose gel electrophoresis. Recommended insert size ranges using this method range from 200 bp to 700 bp. This protocol requires an input of 500 to 2000 ng of genomic DNA.
    • The Illumina TruSeq DNA PCR-Free Sample Preparation Kit [5] requires an input of 1000 ng of genomic DNA input to construct a library with an average insert size of 350 bp or an input of 2000 ng of genomic DNA input to construct a library with an average insert size of 550 bp. Libraries are constructed in the absence of pcr to minimize bias of representation in the sequence reads.
    • The Illumina TruSeq Nano DNA Sample Preparation Kit is currently available as a beta test product. This kit requires an input of 100 ng of genomic DNA to construct a library with an average insert size of 350 bp or an input 200 ng of genomic DNA to construct a library with an average insert size of 550 bp. Eight cycles of PCR are required to complete construction of the library.
  • Purification of Genomic DNA: Genomic DNA should be extracted using a column based purification method such as the Qiagen DNeasy kit or the Qiagen Genomic-Tip System. DNA samples should be treated with RNase prior to purifcation on the column. Do not overload Qiagen columns during DNA purification.
  • Avoid oragnic extraction methods: We recommend that you avoid organic extraction methods (such as phenol or Trizol) to purify genomic DNA. Organic carryover can inhibit the enzymatic reactions used in Illumina library preparation. Furthermore, the EtOH precipitation step that follows an organic extraction can result in the co-precipitation of small oligos and other impurities that may exagerate the estimated concentration of DNA in the sample. These contaminants may adversely affect construction of the sequencing library.
  • Assessment of DNA quality: The quality of genomic DNA can be assessed by running an aliquot of the sample (approximately 50-100 ng) on a 1% agarose gel stained with ethidium bromide. Intact genomic DNA should appear as a high molecular weight band (>10,000 bp) with no lower molecular weight smear. Low molecular smearing may also be indicative of the presence of RNA. All DNA samples should be treated with RNase prior to submission for sequencing.
  • Volume of DNA: DNA samples should be delivered to the Microarray and Genomic Analysis Core Facility in a volume of 50 μl.
  • Genomic DNA Library Prep: The genomic DNA sample will be fragmented on a Covaris Adaptive Focused Acoustics Model S2 instrument to enrich for fragments in the desired size range.Genomic DNA library prep invovles end repair, adenylation of DNA ends, ligation of adapters and pcr for some protocols.
  • Size Selection of sequencing library: The optimal size range for an Illumina sequencing library is 150-800 bp. The adapters of the sequencing library have a combined size of 120 bp.
  • Sequence lanes: A single library preparation should yield sufficient sample such that multiple lanes of DNA sequence analysis can be performed on the library. We store sequencing libraries for up to two years in case investigators need additional lanes of sequence from their libraries.

[edit] Recommendation for Illumina TruSeq ChIP Sample preparation

Chromatin immunoprecipitation (ChIP) sequencing enables an investigator to determine the distribution and abundance of DNA-bound protein targets across the genome. We construct ChIP sequencing libraries using the Illumina TruSeq ChIP Sample Preparation Kit [6]. All Illumina TruSeq sample preparation kits enable multiplexing of different libraries within the same sequencing lane. Recomendations are provided below for preparing ChIP samples for Illumina library construction.


NOTE: It is absolutely critical that every ChIP-Seq experiment include a positive control, we recommend H3K4Me3. PolII is also good but doesn't consistently work. Running both would be ideal and a requirement for technicians who are starting out with ChIP-Seq experiments. Barring these controls one cannot troubleshoot issues when they arise nor trust the novel findings. Thus a recommended experiment design is 1 H3K4Me3 chIP, 1 PolII chIP, 3 experiment chIP bio replicas, 3 experiment input control bio replicas. Multiplex all 8 samples in 1 lane single end 50bp HiSeq. ~$2270 for library and seq charges Oct 2013


  • Microcentrifuge Tubes: We recommend the use of Eppendorf LoBind microcentrifuge tubes for all steps of ChIP-seq experiments (Fisher cat# 13-6987-91). LoBind tubes improve recovery by reducing sample to tube binding without the use of any coatings or additives. LoBind tubes are pcr clean and likewise are RNase/DNase-free.
  • Carrier DNA: Do not use salmon sperm DNA, calf thymus DNA or other DNA based carriers as a blocking agent at any step during the immunoprecipitation process. Carrier DNA that is added to your sample can function as template during Illumina library preparation and will contribute to the sequence reads along with your sample.
  • Magnetic Beads: Dynabeads do not readily absorb random DNA from the immunoprecipitation cocktail and therefore are preferred over Sepharose, Sephadex etc.
  • Formaldehyde crosslinking: The concenentration and incubation time of formaldehyde should be optimized by the user. As an initial guideline, a concentration of 1% formaldehyde for 5-15 minutes is common. Use Fisher Scientific catalog #BP531-500 or equivalent as stock source of formaldehyde.
  • DNA shearing and epitope monitoring: Investigators should aim for a mojority of their crosslinked chromatin fragments to be in the 200-600 bp size range while ensuring the integrity of their protein. Fragmentation can be accomplished using either Covaris, Bioruptor, or by tip probe sonicator. This should initially be performed as a time series as a means to optimize the fragmentation time and power settings, monitored by agarose gel electrophoresis. Fragmentation conditions can also be monitored by western blot analysis of aliquots of the input at different time points to monitor the presence of the protein that the ChIP Ab is directed against. Certain proteins are very susceptible to epitope destruction dduring shearing. Determine the time range that is optimal for fragmentation and also optimal for retention of protein.
    • Run an aliquot of de-crosslinked/RNase treated input on a gel and verify that the DNA is in a 100-700 bp size range. Larger sized fragments do not efficiently form clusters on Illumina sequencing flowcells.
    • Define an optimal concentration of cells for shearing and follow that standard in each experiment. Variations in the number of cells used can affect shearing.
    • Tip probe sonnicators may result in variability of size range from one sample to the next. This is the least consistent method of fragmentation, but some investigators find that this method best preserves protein epitopes.
    • When using the Covaris instrument for fragmentation, refer to the most recent protocols available on their website. Keep power level and time length minimized. Be familiar with the current protocols and not the old protocols.
      • Protocol for Covaris truChIP High Cell Chromatin Shearing Kit with non-ionic shearing buffer: [7]
      • Protocol for Covaris truChIP High Cell Chromatin Shearing Kit with SDS shearing buffer: [8]
      • Protocol for Covaris truChIP Low Cell Chromatin Shearing Kit with non-ionic shearing buffer: [9]
      • Protocol for Covaris truChIP Low Cell Chromatin Shearing Kit with SDS shearing buffer: [10]
  • Purification of ChIP and input samples: Samples should be purified using a Qiagen Qiaquick PCR purification kit. ChIP samples can be cleaned up using the Qiagen MinElute PCR Purification Kit which enables elution of ChIP DNA in volumes as small as 10 ul if multiple samples are going to be prepared prior to submitting the ChIP sample to teh core facility. ChIP library construction protocols allow for a maximum of 50 ul of sample per reaction. Avoid the use of organic compounds including phenol/chloroform as these reagents may adversely affect the enzymatic steps invovled in library construction. Likewise, EtOH precipitated samples may contain salts and other contaminants that adversely affect the enzymes used in teh construction of the Illumina sequencing library.
  • Quantification of Sample: The concentration of ChIP samples can be measured by a pico-green assay (the concentration of these samples will be too low to accurately quantitate on a NanoDrop). Invitrogen sells a relatively inexpensive fluorometer, the Qubit, which can be used for this purpose [11]. Quantification of the samples should be done prior to verification of enrichment of known binding sites by qPCR. A minimum of 5-10 ng of ChIP DNA is required for constructing an Illumina sequencing library. If you have less than this quantity, pool multiple ChIP samples together. ChIP samples should be in a volume of 50 ul.
  • Quantification of Enrichment by qPCR: Following the pico-green assay, all ChIP samples should be adjusted to a similar concentration. Create a dilution series of your input DNA that includes the concentration range of your ChIP samples. Perform qPCR using this dilution series of your input sample. Qualify the concentration/enrichment of a few known targets in comparison to a set of negative targets in your ChIP sample and compare these to the concentrations in the input sample. You will need to do a titration series and the two samples being compared should be in a similar concentration range.
  • Quantify the DNA fragment size following ChIP: Run the ChIP samples on a Bioananlzyer DNA High Sensitivity chip and define the size range (samples should be purified in EB using a Qiagen QIAquick PCR purification kit or a Qiagen QIAquick MinElute PCR purification kit). We commonly observe that the average size range of ChIP samples is somewhat higher than the average size range of the input sample that they were derived from. If the size is above 800 bp, the sample can be further fragmented in a volume of 55 ul on the Covaris S2 instrument such that the size range is apprpriate for construction of an Illumina sequencing library (average size of 350 bp). Alternatively, you can attempt further fragmentation using the Bioruptor.
  • ChIP-seq Library Prep: A minimum of 5-10 ng of ChIP DNA is required for constructing an Illumina sequencing library. If you have less than this quantity, pool multiple ChIP samples together. ChIP samples should be in a volume of 50 ul. To ensure the best enrichment ratios, it is important to have an efficient library prep that minimizes PCR cycles, while still yielding enough product for the sequencing step. Library prep involves end repair, adenylation of DNA ends, ligation of adapters and pcr amplification. The size selection step of library construction is avoided by verifying that all ChIP DNA is in an apprpriate size range (200-700 bp) prior to construction of the library. Ten cycles of PCR are performed to enrich the ChIP library. This results in a minimal quantity of DNA to use for sequencing.
  • Validation of enrichment following library construction: If desried, an aliquot of the library can be acquired from the core facility following library construction and before sequencing. Enrichment of known targets and off targets can be validated by qPCR by comparing the ChIP libraries to the input library. All libraries should be normalized to a similar concentration prior to assembling the qPCR reactions. If qPCR fails to show enrichment, you can consider terminating the sequencing request. If ChIP libraries show enrichment, then you can opt to proceed with sequencing.
  • Number of sequence reads: For higher eukaryotes, 10-20 million mapped reads per sample are recommended for performing a whole genome ChIP analysis.
  • ChIP User Experience Link.

[edit] Recommendations for Illumina TruSeq RNA Sample Preparation

The Illumina TruSeq RNA Sample Preparation Kit v2 [12] provides a solution for gene expression profiling through the construction of mRNA-focused libraries from total RNA. All Illumina TruSeq sample preparation kits enable multiplexing of different libraries within the same sequencing lane. RNA sequencing libraries are routinely run on an Illumina HiSeq 50 cycle single read sequencing run which yields approximately 150-200 million reads per lane. Since all Illumina TruSeq sample preparation kits enable multiplexing of different libraries, multiple libraries can be sequenced in the same lane. For gene expression profiling, we recommend multiplexing libraries (constructed from eukaryotic organisms) such that each individual library is represented by approximaltey 15 million reads. Recomendations are provided below for preparing total RNA samples for Illumina library construction.

  • RNA should be provided as total RNA. Preferred sample preparation methods include the Qiagen RNeasy kit, Qiagen Tissue and lipid RNeasy kit, Qiagen miRNeasy kit and Qiagen microarray RNeasy kit. If working with plant or fungi, it is recommended to use the Qiagen RNeasy Plant mini kit.
  • RNA samples should be treated with DNase. This step should be included and performed during the Qiagen RNeasy purification methods. DNase for this procedure should also be acquired from Qiagen, but must be ordered separately from the standard kit.
  • Do not overload Qiagen columns during DNA purification. Overloading columns can introduce impurities (guanidine, protein, carbohydrate) that can have inhibitory activity during the Illumina library preparation protocol.
  • Tissues with a high fat content and certain embryonic tissues require an organic step as a means to remove the excess amount of these other biomolecules. To accomplish this, we recommend the use of one of the following Qiagen kits: Qiagen RNeasy Lipid Tissue Mini Kit, Qiagen RNeasy microarray tissue mini kit, or Qiagen miRNeasy mini kit. All three of these kits do inlcude an organic step prior to column purification.Residual DNA can also be removed during the purification process when using any of these three kits.
  • The use of phenol or Trizol are discouraged for the purifcation of total RNA. We likewise discourage the precipitation of RNA following organic extraction even if subsequent cleanup is performed using a column-based purification method (such as RNeasy). Organic carryover can inhibit the enzymatic reactions used in Illumina library preparation and can increase the risk of failure of library generation. Ethanol/Isopropanol precipitation can co-precipitate various contaminants (carbohydrates, proteins, lipids) along with the nucleic acid sample. We are unable to guarantee sucessful library construction of any sample that has been prepared by these methods.* The quantity of total RNA recommended for the construction of an Illumina RNA-seq Sequencing Library is 100 ng to 4 μg. The total RNA sample should be delivered to the Microarray Core Facility in a volume of 50 μl at a concentration of 25 ng/μl if total RNA is not a limiting factor. This volume of sample will also allow us to perform appropriate quality control steps on the sample. Please normalize the concentration of all samples.
  • Prior to constructing an Illumina sequencing library, total RNA quality is validated by running an aliquot of the sample on an Agilent Bioanalyzer RNA NanoChip. The client will be contacted following the Bioanalyzer run and prior to library preparation if there are any concerns about the quality of the RNA sample.
  • The protocol for the Illumina TruSeq RNA Sample Preparation kit includes a step in which polyA RNA will be selected by oligo-dT magnetic beads. If you prefer that your sample is not enriched for polyA, please communicate your preferences to the core facility when submitting the sequencing request on GNomEx. If the polyA selection step is bypassed, library construction can be initiated with 50 ng of RNA. This sample should be provided in a total volume of 15 μl. The excess sample that is requested will be used to perform appropriate quality control steps.
  • RNA is chemically fragmented prior to reverse transcription and subsequent library construction. The fragmentation step results in an RNA-seq library that includes inserts that range in size from approximatley 100-400 bp. The median insert size in an Illumina TruSeq RNA sequencing library is approximatley 160 bp.
  • Following construction of an Illumina sequencing library, the library will be validated by running an aliquot of the sample on an Agilent Bioanalyzer chip and defining the concentration of the sample using a qPCR assay.
  • A single Illumina library preparation will yield sufficient sample such that numerous lanes of sequence analysis can be performed.
  • Pricing for Illumina HiSeq 2000 mRNA-Seq Sequencing Services.

[edit] Recommendations for Illumina TruSeq Stranded mRNA Sample Preparation

The Illumina TruSeq Stranded mRNA Sample Prep Kit [13] enables construction of an mRNA sequencing library that provides strand orientation, enhanced transcript annotation and increased alignment efficiency. The Illumina TruSeq Stranded mRNA Sample Prep Kit includes a step in which polyadenylated RNA molecules are captured by magnetic beads containing oligo dT. Stranded RNA sequencing libraries routinely have an insert size that ranges from 100 bp to 400 bp and these libraries are routinley sequenced on an Illumina HiSeq 50 cycle single read sequencing run. All Illumina TruSeq sample preparation kits enable multiplexing of different libraries within the same sequencing lane. Recomendations are provided below for preparing total RNA samples for Illumina library construction.

  • RNA should be provided as total RNA. Preferred sample preparation methods include the Qiagen RNeasy kit, Qiagen Tissue and lipid RNeasy kit, Qiagen miRNeasy kit and Qiagen microarray RNeasy kit. If working with plant or fungi, it is recommended to use the Qiagen RNeasy Plant mini kit.
  • RNA samples should be treated with DNase. This step should be included and performed during the Qiagen RNeasy purification methods. DNase for this procedure should also be acquired from Qiagen, but must be ordered separately from the standard kit.
  • Do not overload Qiagen columns during DNA purification. Overloading columns can introduce impurities (guanidine, protein, carbohydrate) that can have inhibitory activity during the Illumina library preparation protocol.
  • Tissues with a high fat content and certain embryonic tissues require an organic step as a means to remove the excess amount of these other biomolecules. To accomplish this, we recommend the use of one of the following Qiagen kits: Qiagen RNeasy Lipid Tissue Mini Kit, Qiagen RNeasy microarray tissue mini kit, or Qiagen miRNeasy mini kit. All three of these kits do inlcude an organic step prior to column purification.Residual DNA can also be removed during the purification process when using any of these three kits.
  • The use of phenol or Trizol are discouraged for the purifcation of total RNA. We likewise discourage the precipitation of RNA following organic extraction even if subsequent cleanup is performed using a column-based purification method (such as RNeasy). Organic carryover can inhibit the enzymatic reactions used in Illumina library preparation and can increase the risk of failure of library generation. Ethanol/Isopropanol precipitation can co-precipitate various contaminants (carbohydrates, proteins, lipids) along with the nucleic acid sample. We are unable to guarantee sucessful library construction of any sample that has been prepared by these methods.
  • The quantity of total RNA recommended for the construction of an Illumina library using the Illumina TruSeq Total RNA Sample Prep Kit is 100 ng to 4 μg. The total RNA sample should be delivered to the Microarray Core Facility in a volume of 50 μl at a concentration of 25 ng/μl if total RNA is not a limiting factor. This volume of sample will also allow us to perform appropriate quality control steps on the sample. Please normalize the concentration of all samples.
  • Prior to constructing an Illumina sequencing library, total RNA quality is validated by running an aliquot of the sample on an Agilent Bioanalyzer RNA NanoChip. The client will be contacted following the Bioanalyzer run and prior to library preparation if there are any concerns about the quality of the RNA sample.
  • The Illumina TruSeq Total RNA Sample Prep kit includes a step in which cytoplasmic and mictochndrial rRNA will be removed.
  • RNA is chemically fragmented prior to reverse transcription and subsequent library construction. The fragmentation step results in an RNA-seq library that includes inserts that range in size from approximatley 100-400 bp. The median insert size in an Illumina TruSeq RNA sequencing library is approximatley 160 bp.
  • Following construction of an Illumina sequencing library, the library will be validated by running an aliquot of the sample on an Agilent Bioanalyzer chip and defining the concentration of the sample using a qPCR assay.
  • A single Illumina library preparation will yield sufficient sample such that numerous lanes of sequence analysis can be performed.
  • Pricing for Illumina HiSeq 2000 Stranded Total RNA Sequencing Services.

[edit] Recommendations for Illumina TruSeq Stranded Total RNA Sample Preparation

The Illumina TruSeq Stranded Total RNA Sample Prep Kit [14] provides the most complete solution for characterization of a transcriptome by providing information on strand orientation for all RNA molecules, with the exception of rRNA, in addition to gene expression profiling. The Illumina TruSeq Total RNA Stranded Sample Prep Kit includes Ribo-Zero Human/Mouse/Rat which enables removal of both cytoplasmic rRNA and mictochondrial rRNA. The Ribo-Zero kit has been optimized for use on human, mouse and rat samples, however, it has been shown to also work on samples derived from other organisms [15]. Stranded RNA sequencing libraries routinely have an insert size that ranges from 100 bp to 400 bp, however, these libraries can be optimized for insert sizes larger than 180 bp and can be sequenced on either an Illumina HiSeq 50 cycle single read sequencing run or an Illumina HiSeq 101 paired end read sequncing run. All Illumina TruSeq sample preparation kits enable multiplexing of different libraries within the same sequencing lane. Recomendations are provided below for preparing total RNA samples for Illumina library construction.

  • RNA should be provided as total RNA. Preferred sample preparation methods include the Qiagen RNeasy kit, Qiagen Tissue and lipid RNeasy kit, Qiagen miRNeasy kit and Qiagen microarray RNeasy kit. If working with plant or fungi, it is recommended to use the Qiagen RNeasy Plant mini kit.
  • RNA samples should be treated with DNase. This step should be included and performed during the Qiagen RNeasy purification methods. DNase for this procedure should also be acquired from Qiagen, but must be ordered separately from the standard kit.
  • Do not overload Qiagen columns during DNA purification. Overloading columns can introduce impurities (guanidine, protein, carbohydrate) that can have inhibitory activity during the Illumina library preparation protocol.
  • Tissues with a high fat content and certain embryonic tissues require an organic step as a means to remove the excess amount of these other biomolecules. To accomplish this, we recommend the use of one of the following Qiagen kits: Qiagen RNeasy Lipid Tissue Mini Kit, Qiagen RNeasy microarray tissue mini kit, or Qiagen miRNeasy mini kit. All three of these kits do inlcude an organic step prior to column purification.Residual DNA can also be removed during the purification process when using any of these three kits.
  • The use of phenol or Trizol are discouraged for the purifcation of total RNA. We likewise discourage the precipitation of RNA following organic extraction even if subsequent cleanup is performed using a column-based purification method (such as RNeasy). Organic carryover can inhibit the enzymatic reactions used in Illumina library preparation and can increase the risk of failure of library generation. Ethanol/Isopropanol precipitation can co-precipitate various contaminants (carbohydrates, proteins, lipids) along with the nucleic acid sample. We are unable to guarantee sucessful library construction of any sample that has been prepared by these methods.
  • The quantity of total RNA recommended for the construction of an Illumina library using the Illumina TruSeq Total RNA Sample Prep Kit is 100 ng to 4 μg. The total RNA sample should be delivered to the Microarray Core Facility in a volume of 50 μl at a concentration of 25 ng/μl if total RNA is not a limiting factor. This volume of sample will also allow us to perform appropriate quality control steps on the sample. Please normalize the concentration of all samples.
  • Prior to constructing an Illumina sequencing library, total RNA quality is validated by running an aliquot of the sample on an Agilent Bioanalyzer RNA NanoChip. The client will be contacted following the Bioanalyzer run and prior to library preparation if there are any concerns about the quality of the RNA sample.
  • The Illumina TruSeq Total RNA Sample Prep kit includes a step in which cytoplasmic and mictochndrial rRNA will be removed.
  • RNA is chemically fragmented prior to reverse transcription and subsequent library construction. The fragmentation step results in an RNA-seq library that includes inserts that range in size from approximatley 100-400 bp. The median insert size in an Illumina TruSeq RNA sequencing library is approximatley 160 bp.
  • Following construction of an Illumina sequencing library, the library will be validated by running an aliquot of the sample on an Agilent Bioanalyzer chip and defining the concentration of the sample using a qPCR assay.
  • A single Illumina library preparation will yield sufficient sample such that numerous lanes of sequence analysis can be performed.
  • Pricing for Illumina HiSeq 2000 Stranded Total RNA Sequencing Services.

[edit] Small RNA Sequencing Recommendations

  • RNA samples for small RNA library construction should be provided as total RNA. Preferred sample preparation methods include the Qiagen miRNeasy kit.
  • RNA samples should be treated with DNase. This step can be performed during the Qiagen miRNeasy purification protocol. DNase for this procedure can be purchased from Qiagen. It is recommended as an optional step in the RNA purificaiton protocol, however, the reagent must be purchased separately from the miRNeasy kit.
  • Do not overload Qiagen columns during DNA purification. Overloading columns can introduce impurities (guanidine, protein, carbohydrate) that can have inhibitory activity during the Illumina library preparation protocol.
  • When measuring the concentration of your samples on a spectrophotometer, pay attention to the A260/A230 ratio. This should be approximately 1.8 to 2.2. Lower numbers indicate contaminants that absorb at A230. Ratios below 1.2 can suggest that a substantial fraction of your calculated concentration may be contributed by the peak at A230 and that your RNA concentration is somewhat lower than predicted.
  • We discourage purification methods that rely solely on organic reagents. We likewise discourage the precipitation of RNA following organic extraction even if subsequent cleanup is performed using a column-based purification method (such as RNeasy). Organic carryover can inhibit the enzymes used during the Illumina library preparation protocol and can increase the risk of failure of library construction. Ethanol/Isopropanol precipitation can co-precipitate various contaminants (carbohydrates, proteins, lipids) along with the nucleic acid sample. We are unable to guarantee sucessful library construction of any sample that has been prepared by these methods.
  • The quantity of total RNA recommended for quality control of the sample and the construction of an Illumina Small RNA Sequencing Library is 2 μg. The total RNA sample should be delivered to the Microarray Core Facility in a volume of 10 μl at a concentration between 200 ng/μl. This volume of sample will also allow us to perform appropriate quality control steps on the sample. Please normalize the concentrations of all samples.
  • The quality of the total RNA sample will be accessed on an Agilent Bioanalyzer RNA6000 NanoChip prior to starting construction of the sequencing library. The client will be contacted following the Bioanalyzer run and prior to library preparation if there are any concerns about the quality of the RNA sample.
  • Note: during alignment of the reads you should trim the 3' adaptor sequence, which is "ATCTCGTATGCCGTCTTCTGCTTG". Using the novoalign aligner, this is accomplished with the argument "-a ATCTCGTATGCCGTCTTCTGCTTG".
  • Pricing for Illumina HiSeq 2000 small RNA Sequencing Services.

[edit] Exome Capture/Target Enrichment Sequencing Recommendations

  • Purification of Genomic DNA: Genomic DNA should be extracted using a column based purification method such as the Qiagen DNeasy kit or the Qiagen Genomic-Tip System. DNA samples should be treated with RNase prior to purifcation on the column. Do not overload Qiagen columns during DNA purification.
  • Avoid oragnic extraction methods: We recommend that you avoid organic extraction methods (such as phenol or Trizol) to purify genomic DNA. Organic carryover can inhibit the enzymatic reactions used in Illumina library preparation. Furthermore, the EtOH precipitation step that follows an organic extraction can result in the co-precipitation of small oligos and other impurities that may exagerate the estimated concentration of DNA in the sample. These contaminants may adversely affect construction of the sequencing library.
  • Assessment of DNA quality: The quality of genomic DNA can be assessed by running an aliquot of the sample (approximately 50-100 ng) on a 1% agarose gel stained with ethidium bromide. Intact genomic DNA should appear as a high molecular weight band (>10,000 bp) with no lower molecular weight smear. Low molecular smearing may also be indicative of the presence of RNA. All DNA samples should be treated with RNase prior to submission for sequencing.
  • Quantity of DNA: There are two major commercial vendors of exome capture kits that we support: Agilent SureSelect and Illumina TruSeq target enrichment
    • Illumina TruSeq Target Enrichment: The quantity of genomic DNA recommended for the construction of an Illumina exome capture Sequencing Library is 1 μg. The genomic DNA sample should be delivered to the Microarray Core Facility in a volume of 50 μl at a concentration of 25 ng/μl. This volume of sample will also allow us to perform appropriate quality control steps on the sample. Please normalize the concentration of all samples.
    • Agilent SureSelect: The quantity of genomic DNA recommended for the construction of an Agilent Exome Capture Sequencing Library is 3 μg. The genomic DNA sample should be delivered to the Microarray Core Facility in a volume of 65 μl at a concentration of 50 ng/μl. This volume of sample will also allow us to perform appropriate quality control steps on the sample. Please normalize the concentration of all samples.
  • Genomic DNA Library Prep: The genomic DNA sample will be fragmented on a Covaris Adaptive Focused Acoustics Model S2 instrument. This process will randomly fragment the sample to a size range of 200-500 bp. Genomic DNA library prep invovles end repair, adenylation of DNA ends, ligation of adapters and limited pcr. The library is validated on the bioanalyzer prior to capture of targeted regions.
  • Target Enrichment: There are three major commercial vendors of exome capture kits: Agilent SureSelect, Illumina TruSeq target enrichment, and NimbleGen SeqCap EZ Exome kit. Features of these kits are described below.
    • Agilent SureSelect Target Enrichment [16]
      • Requires 3 ug of input genomic DNA
      • Catalog kits are available for human,mouse, zebrafish, canine, and bovine exome capture and custom design options are also available.
      • Length of capture oligos: 114-126 nucletide RNA baits
      • Total coverage: 51,542,882 bp for Agilent SureSelect Human All Exon v2 kit
      • Features: One day capture hybridization, one sample per capture, libraries are barcoded during pcr after the target enrichment.
    • Illumina TruSeq Target Enrichment [17]
      • Requires 1 ug of input genomic DNA
      • A catalog kit is available for for human exome capture and for custom design options are also available.
      • Length of capture oligos: 95 nucleotide DNA baits
      • Total coverage: 61,884,224 bp for Illumina TruSeq Human Exome Enrichment kit kit
      • Features: Two consecutive one day hybridizations, libraries are barcoded prior to capture, can combine up to six libraries per capture reaction.
    • NimbleGen SeqCap EZ Exome Kit [18]
      • Requires 3 ug of input genomic DNA
      • A catalog kit is available for human exome capture and for mouse exome capture.
      • Length of capture oligos: 55-105 nucleotide DNA baits
      • Total coverage: 44,007,233 bp for NimbleGen SeqCap EZ Exome Library 2.0
      • Features: Three day hybridization, libraries are barcoded prior to capture.
  • Sequencing of Exome Capture Libraries: Most exome capture libraries are sequenced on a 101 cycle paired end sequencing run on the Illumina HiSeq 2000. It is recommended to analzye 80 million mapped reads per exome.
  • Pricing for ExomeCapture/Target Enrichment and Illumina HiSeq 2000 Sequencing Services.

[edit] Custom Library Preparation and Sequencing Recommendations



[edit] Array Capture/DNA Sequencing Recommendations

  • Consult with the Bioinformatics Core Facility on the design of a custom microarray that can be used for the Array Capture experiment.
  • Microarray Slides for Array Capture experiments can be designed in the following formats (arrays per slide x features per array): 1 x 1M; 1 x 244K; 2 x 105K.
  • Genomic DNA should be provided as high molecular weight DNA. Preferred sample preparation methods include the Qiagen DNeasy kit and the Qiagen Genomic-Tip System.
  • Do not overload Qiagen columns during DNA purification. Overloading columns can introduce impurities (guanidine, protein, carbohydrate) that can have inhibitory activity during the Illumina library preparation protocol.
  • DNA samples should be treated with RNase. This step should be included and performed during the Qiagen DNeasy or Qiagen Genomic-tip purification methods.
  • Avoid organic extraction methods (such as phenol or Trizol) to purify genomic DNA. Organic carryover can inhibit the enzymatic reactions used in Illumina library preparation. If an organic extraction method is used, this should be followed by purification on a Qiagen spin column. To remove residual organic contamination in a DNA sample it is recommended to use the Qiagen DNeasy kit.
  • The recommended quantity of genomic DNA needed to create an Illumina DNA sequencing library for Array Capture experiments is 1-5 μg of DNA. The genomic DNA sample (50 μl) should be provided to the Microarray Core Facility at a concentration between 20-100 μg/μl. It is preferred that a quantity on the high end of this concentration range is provided.
  • A single library preparation will yield sufficient samples such that numerous lanes of DNA sequence analysis can be performed.
  • Genomic DNA quality can be accessed by running approximately 50 ng of the sample on a 1% agarose gel stained with Ethidium Bromide. Intact genomic DNA should appear as a high molecular weight (>10,000 bp) band with no lower molecular weight smear. A small amount of low molecular weight smear may be acceptable; however, this should be limited. A significant amount of visible low molecular smearing may be detrimental to library generation.
  • The genomic DNA sample will be fragmented by nebulization during the library preparation procedure. This process will uniformly reduce the size of the genomic DNA to an optimal range of 200-800 bp.
Personal tools